MIR744 is a non-conserved miRNA that has been discovered in one or a few species [PMC9879538]. It is involved in the post-transcriptional regulation of TGF-beta1, which plays a role in cellular processes such as proliferation, differentiation, migration, and survival [PMC3828615]. In breast cancer (BC), MIR744 has been found to be hypomethylated and up-regulated in 56% of cases [PMC3828615]. It is also activated by bortezomib-mediated activation of CEBPD [PMC8308509]. MIR744 is one of the miRNA regulators expressed in cumulus cells (CCs), along with MIR425, MIR146b, Let-7d, MIR202, and Let-7e [PMC4168028]. Interestingly, MIR202 has been identified as a potential regulator of the aging and angiogenesis-related gene HAS2 [PMC4168028]. NONO interacts with several miRNAs including MIR744 and protein-coding genes such as CELF2 and KRT8 [PMC9730017]. In addition to BC, MIR744 has also been associated with poor prognosis in nasopharyngeal carcinoma (NPC) [PMC6368411]. It has been shown to induce the expression of Cyclin B1 in mouse cell lines along with miR1186 and miR466d-3p [PMC4696257]. The 5'-flanking region of MAP2K4 (host gene of intronic MIR744) was cloned from THP-1 cells using PCR techniques [PMC5775404]. The mature sequence of MIR744 was synthesized to generate a construct that inhibits its expression for functional studies [PMC5362436].
-- c GC C - U gucuuacugaa c uuggg aaggU GGGG UAG GGC AACAGCA gguuuc ||||| ||||| |||| ||| ||| ||||||| |||||| u ggcuc uUCCA CUCC AUC CCG UUGUCgu ccaaag cu a -A A A - ----acacgca g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004945 |
Description | Homo sapiens hsa-miR-744-5p mature miRNA |
Sequence | 11 - UGCGGGGCUAGGGCUAACAGCA - 32 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004946 |
Description | Homo sapiens hsa-miR-744-3p mature miRNA |
Sequence | 68 - CUGUUGCCACUAACCUCAACCU - 89 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|