Hsa-mir-190b, an miRNA, was found to be upregulated and involved in the regulation of FGF2 downregulation, which in turn alleviated the inflammatory response and vascular endothelial injury [PMC8923688]. Additionally, hsa-mir-190b was found to activate the expression of FGF2 and FGFR1 proteins [PMC8923688]. On the other hand, hsa-mir-190b and hsa-miR-449a were identified as the most significantly downregulated miRNAs [PMC7499949]. The upregulation of hsa-mir-190b suggests its potential role in modulating FGF2 expression [PMC8923688]. This regulation of FGF2 may contribute to the alleviation of inflammatory response and vascular endothelial injury [PMC8923688'>PMC8923688'>PMC8923688'>PMC8923688]. The activation of FGF2 and FGFR1 protein expression by hsa-mir-190b further supports its involvement in cellular processes [PMC8923688]. In contrast to its upregulation, hsa-mir-190b was found to be downregulated along with hsa-miR-449a [PMC7499949]. This downregulation suggests a potential role for these miRNAs in different cellular processes or pathways [PMC7499949]. In summary, hsa-mir-190b is an miRNA that is upregulated and involved in regulating FGF2 expression [PMC8923688]. This regulation may contribute to alleviating inflammatory response and vascular endothelial injury while activating FGF2 and FGFR1 protein expression [PMC8923688]. Additionally, both hsa-mir-190b and hsa-miR-449a were significantly downregulated [PMC7499949] [PMC8923688].
- u -U G - aa ugcu cugug GAUAUGUUUGAUAUU GGUUG uuu u |||| ||||| ||||||||||||||| ||||| ||| acga gacau UUAUACAAACUGUAA UCAac aag u g c UC A c ga
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004929 |
Description | Homo sapiens hsa-miR-190b-5p mature miRNA |
Sequence | 11 - UGAUAUGUUUGAUAUUGGGUUG - 32 |
Evidence | not_experimental |
Database links | |
Predicted targets |
Accession | MIMAT0037332 |
Description | Homo sapiens hsa-miR-190b-3p mature miRNA |
Sequence | 48 - ACUAAAUGUCAAACAUAUUCU - 68 |
Evidence | not_experimental |
|