![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR815b |
|||||
Accession | MI0005243 (change log) | ||||
Description | Oryza sativa miR815b stem-loop | ||||
Gene family | MIPF0000349; MIR815 | ||||
Literature search |
2 open access papers mention osa-MIR815b | ||||
Stem-loop |
a u uu cuc ag c 5' cuaaugguucaccucguuuugcguau uucccaaucuucuc au ccuucuc aaacac c u |||||||||||||||||||||||||| |||||||||||||| || ||||||| |||||| | 3' gauuaccgaguggagcaaaaugcaua aaggguuagaggag ua ggaagag uuugug g g g u gg --- -a g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: low
| ||||
Comments |
miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR815b |
|
Accession | MIMAT0004059 |
Sequence |
81 - aaggggauugaggagauuggg - 101 |
Deep sequencing | 3558 reads, 2 experiments |
Evidence | experimental; cloned [1], Northern [1] |
Database links |
|
References |
|
1 |
PMID:16959252
"Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development"
FEBS Lett. 580:5111-5116(2006).
|