![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1283-1 |
||||||||||||||||||||||||
Accession | MI0003832 (change log) | |||||||||||||||||||||||
Symbol | HGNC:MIR1283-1 | |||||||||||||||||||||||
Description | Homo sapiens miR-1283-1 stem-loop | |||||||||||||||||||||||
Gene family | MIPF0000020; mir-515 | |||||||||||||||||||||||
Literature search |
5 open access papers mention hsa-mir-1283-1 | |||||||||||||||||||||||
Stem-loop |
-- ua g ac a g g c 5' cucaagc uga ucu aaagg aagcgcuuucu uu u a ||||||| ||| ||| ||||| ||||||||||| || | g 3' gaguuug auu gga uuucc uucgcgaaaga aa a a aa gc g gu c g g a |
|||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-1283 |
|
Accession | MIMAT0005799 |
Sequence |
14 - ucuacaaaggaaagcgcuuucu - 35 |
Deep sequencing | 4006 reads, 36 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|