MIR454 is a microRNA that has been studied in various contexts, including colorectal tissues, gastric cancer, lymphoma, and frailty. In colorectal tissues, the stability of MIR454 and other miRNAs was assessed to determine appropriate normalizers for different study cohorts [PMC2873395]. However, MIR454 was subsequently excluded from an in vitro study [PMC6659797]. The MIR130 family, which includes MIR454, shares a common seed sequence and can target a common sequence [PMC6659797]. Remarkable correlations were observed between various combinations of MIR130 family members and BHLHE40/41, except for those involving MIR454 [PMC6659797]. In gastric cancer tissues, overexpression of MIR454 was associated with advanced clinical stage and poor prognosis for patients [PMC7185177]. In lymphoma patients, miR21, miR130b, miR155 were upregulated or downregulated along with other miRNAs including MIR454 between diagnosis/remission or relapse/remission [PMC7782091]. In prostate cancer (miR1256), bladder tumors (MIR454), and breast cancer (miR548), different miRNAs including MIR454 have been implicated in their pathogenesis [PMC7920560]. Furthermore,MiR187 has been studied in the context of glioblastoma[PMC4938405]. MIR454 has also been implicated in the regulation of genes involved in tumour progression and metastasis[ PMC8243332].. In frailty research,Mir-1251 is associated with frailty[ PMC8169753].. In summary,Mir-1251 is associated with frailty[ PMC8169753]..'>PMC8169753].. Overall,Mir-1251 is associated with frailty[ PMC8169753]. In glioblastoma,the levels of several microRNAs including Mir-454 are altered[PMC8470251].
u ---- --a c --- ---- --U g cuguuua uc ccagau cuagaACCCUAU CAAUAUUGU CUC GCugu u ||||||| || |||||| |||||||||||| ||||||||| ||| ||||| gacgggu ag gguuug gguuuUGGGAUA GUUAUAACG gag ugaua a g aaca aaa u UUC UGAU ucu a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003884 |
Description | Homo sapiens hsa-miR-454-5p mature miRNA |
Sequence | 24 - ACCCUAUCAAUAUUGUCUCUGC - 45 |
Evidence |
experimental
cloned [1-2] |
Database links | |
Predicted targets |
Accession | MIMAT0003885 |
Description | Homo sapiens hsa-miR-454-3p mature miRNA |
Sequence | 64 - UAGUGCAAUAUUGCUUAUAGGGU - 86 |
Evidence |
experimental
cloned [1-2] |
Database links | |
Predicted targets |
|