![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1468 |
|||||
Accession | MI0003782 (change log) | ||||
Symbol | HGNC:MIR1468 | ||||
Description | Homo sapiens miR-1468 stem-loop | ||||
Gene family | MIPF0000777; mir-1468 | ||||
Literature search |
![]()
3 open access papers mention hsa-mir-1468 | ||||
Stem-loop |
gu gu c c c -u cau 5' ggugg g uu uccguuugc uguuu gcuga gug u ||||| | || ||||||||| ||||| ||||| ||| c 3' cuacc c aa agguaaacg auaaa cgacu uac a ug uu a a a cu uca |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1468-5p |
|
Accession | MIMAT0006789 |
Sequence |
13 - cuccguuugccuguuucgcug - 33 |
Deep sequencing | 928 reads, 125 experiments |
Evidence | experimental; cloned [2], Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-1468-3p |
|
Accession | MIMAT0026638 |
Sequence |
55 - agcaaaauaagcaaauggaaaa - 76 |
Deep sequencing | 11 reads, 10 experiments |
Evidence | experimental; Illumina [3] |
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:18402656
"Hidden layers of human small RNAs"
BMC Genomics. 9:157(2008).
|
3 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|