![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-615 |
|||||
Accession | MI0003628 (change log) | ||||
Symbol | HGNC:MIR615 | ||||
Description | Homo sapiens miR-615 stem-loop | ||||
Gene family | MIPF0000342; mir-615 | ||||
Literature search |
![]()
29 open access papers mention hsa-mir-615 | ||||
Stem-loop |
cuc ag c -uc u cu g ug 5' ggg ggg gggagggggg cccgg gcucggau cgag g c ||| ||| |||||||||| ||||| |||||||| |||| | u 3' ccc ccc cccuucuccc ggguc cgagccug gcuu u u ccc aa - ucu - -- g ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-615-5p |
|
Accession | MIMAT0004804 |
Sequence |
18 - ggggguccccggugcucggauc - 39 |
Deep sequencing | 820 reads, 60 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-615-3p |
|
Accession | MIMAT0003283 |
Previous IDs | hsa-miR-615 |
Sequence |
61 - uccgagccugggucucccucuu - 82 |
Deep sequencing | 9902 reads, 130 experiments |
Evidence | experimental; RT-PCR [1], SAGE [1], cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|