MIR590 is a microRNA that has been found to be upregulated in various conditions, including in all pulmonary arterial hypertension (PA) cases [PMC7652879]. The MIR590 gene contains a single estrogen receptor alpha (ERα) binding site in its promoter region, located 1050 base pairs upstream of the transcription start site [PMC6328622]. Antisense oligonucleotides against MIR590 have been shown to reverse its effects [PMC7215603]. MIR590 has also been found to target Tob1 and TGFβR2, suggesting its role in cardiac fibrosis and epithelial-mesenchymal transition (EMT) [PMC9564062] [PMC4626157]. Additionally, MIR590 has been associated with myocarditis and heart failure [PMC9589260]. It has also been shown to regulate Sp1 expression levels and be involved in various downstream sub-networks, including glucose metabolism and microRNA regulation [PMC5210349] [PMC6052129]. In cancer, MIR590 acts as an oncogene by targeting PPM1F and is a prognostic factor for tumor recurrence [PMC8743668]. It is also involved in EMT along with miR182 and miR183 [PMC7575175] [PMC8743668].
--------uagc a G U G ua u cagucaga au AGCUUAU CAUAAAA UGCAG ugg g |||||||| || ||||||| ||||||| ||||| ||| a guuagucu UG UCGAAUA GUAUUUU AUguc acu a acgacguacaaa c A U A ua g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003258 |
Description | Homo sapiens hsa-miR-590-5p mature miRNA |
Sequence | 16 - GAGCUUAUUCAUAAAAGUGCAG - 37 |
Evidence |
experimental
Microarray [1], SAGE [1], cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004801 |
Description | Homo sapiens hsa-miR-590-3p mature miRNA |
Sequence | 56 - UAAUUUUAUGUAUAAGCUAGU - 76 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|