MIR551B is a microRNA that has been studied to determine its putative targets. Web-based tools like miRanda and Targetscan were used to predict potential targets, and it was found that the 3'-UTR of ZEB1 is a potential target of MIR551B [PMC6563032]. Additionally, it was acknowledged that MIR551B may also activate the promoters of certain target genes [PMC6563032].
agaugugc c ca C --GAGA gug ucuc uggcc uGAAAUCAAG GUGGGU CCug c |||| ||||| |||||||||| |||||| |||| agag gucgg ACUUUGGUUC UACCCA gggc a ----aaua u aG A GCGgaa aag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004794 |
Description | Homo sapiens hsa-miR-551b-5p mature miRNA |
Sequence | 22 - GAAAUCAAGCGUGGGUGAGACC - 43 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0003233 |
Description | Homo sapiens hsa-miR-551b-3p mature miRNA |
Sequence | 61 - GCGACCCAUACUUGGUUUCAG - 81 |
Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
Database links | |
Predicted targets |
|