MIR545 is a pre-mir that has been linked to cell proliferation in colorectal cancer [PMC7199595]. It has been found to be upregulated in endometrial cancer [PMC7199595]. No miRNA prediction binding site tool has identified a statistically supported connection between MIR545 and GPR161 [PMC7199595]. However, it is suggested that both GPR161 and MIR545 may be involved in promoting cell proliferation in UCEC [PMC7199595]. In cervical cancer (CC), it has been found that circ_0067934 interacts with MIR545 as a sponge, inhibiting its expression level [PMC9260044]. Both MIR545 and EIF3C genes are potential gene therapy targets for CC [PMC9260044]. In Lewis Lung Carcinoma cell lines, overexpressed MIR545 inhibits Ku70 activity, suggesting its role in radioresistance [PMC4453103]. The upregulation of MIR545 is HBx-dependent [PMC9280728]. In pancreatic ductal adenocarcinoma, MIR545 directly targets RIG-I, a regulator of antiviral response [PMC6370596]. In experiments testing miRNA mimics, MIR545 was used as a negative control with no observed phenotype compared to mock transfected cells or control siRNA transfected cells [PMC7801944]. Additionally, it has been found that ESRRG is a potential target gene of miR-545/374a and its expression is inversely related to the expression of MIR545[ PMC8789654].. Overall, the research suggests that MIR545 plays important roles in cell proliferation and radioresistance in various cancers.
cccag - ----- a - U A A auaaa ccug g cac uuaguaggc c CAGUAAAUGUUU UU GAUGA u |||| | ||| ||||||||| | |||||||||||| || ||||| g ggac c gug aaucgucCG G GUUAUUUACAAA GA CUacu a ----- a cucga a U U C - cagua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004785 |
Description | Homo sapiens hsa-miR-545-5p mature miRNA |
Sequence | 25 - UCAGUAAAUGUUUAUUAGAUGA - 46 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0003165 |
Description | Homo sapiens hsa-miR-545-3p mature miRNA |
Sequence | 63 - UCAGCAAACAUUUAUUGUGUGC - 84 |
Evidence |
experimental
cloned [1-2] |
Database links | |
Predicted targets |
|