Stem-loop sequence hsa-mir-545

Accession

MI0003516 (change log)

Symbol

HGNC:MIR545

Description

Homo sapiens miR-545 stem-loop

Gene family

MIPF0000098; mir-95

Literature search

11 open access papers mention hsa-mir-545
(18 sentences)

Stem-loop

   cccag    ------g   a         - u            a  a     auaaa 
5'      ccug       cac uuaguaggc c caguaaauguuu uu gauga     u
        ||||       ||| ||||||||| | |||||||||||| || |||||     g
3'      ggac       gug aaucguccg g guuauuuacaaa ga cuacu     a
   -----    accucga   a         u u            c  -     cagua 

Deep sequencing

5414 reads, 11.7 reads per million, 103 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 74287104-74287209 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000394108 ; ABCB7-009; intron 6

  OTTHUMT00000394107 ; ABCB7-006; intron 11

  OTTHUMT00000394029 ; ABCB7-005; intron 11

  OTTHUMT00000057273 ; ABCB7-001; intron 12

  OTTHUMT00000057274 ; ABCB7-002; intron 12

  ENST00000534570 ; ABCB7-009; intron 6

  ENST00000339447 ; ABCB7-006; intron 11

  ENST00000529949 ; ABCB7-005; intron 11

  ENST00000253577 ; ABCB7-001; intron 12

  ENST00000373394 ; ABCB7-002; intron 12

Clustered miRNAs

< 10kb from hsa-mir-545

• hsa-mir-374a: chrX: 74287286-74287357 [-]
• hsa-mir-545: chrX: 74287104-74287209 [-]

Database links

• EntrezGene:MIR545
• HGNC:MIR545
• RNAcentral:URS000075BCC5_9606
• miRBase Tracker:MI0003516

Mature sequence hsa-miR-545-5p

• Accession: MIMAT0004785
• Previous IDs: hsa-miR-545*
• Sequence: 25 - ucaguaaauguuuauuagauga - 46
• Deep sequencing: 1696 reads, 70 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00004C4520_9606
• Predicted targets:
  • TargetMiner:hsa-miR-545-5p
  • TargetScanVert:hsa-miR-545-5p
  • miRDB:hsa-miR-545-5p
  • microrna.org:hsa-miR-545-5p

Mature sequence hsa-miR-545-3p

• Accession: MIMAT0003165
• Previous IDs: hsa-miR-545
• Sequence: 63 - ucagcaaacauuuauugugugc - 84
• Deep sequencing: 3629 reads, 80 experiments
• Evidence: experimental; cloned [1-2]
• Database links:
  • RNAcentral:URS00002E1509_9606
• Predicted targets:
  • TargetMiner:hsa-miR-545-3p
  • TargetScanVert:hsa-miR-545-3p
  • miRDB:hsa-miR-545-3p
  • microrna.org:hsa-miR-545-3p

References

1. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).