![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR531a |
|||||
Accession | MI0003204 (change log) | ||||
Previous IDs | osa-MIR531 | ||||
Description | Oryza sativa miR531 stem-loop | ||||
Gene family | MIPF0000607; MIR531 | ||||
Literature search |
![]()
8 open access papers mention osa-MIR531a | ||||
Stem-loop |
c cu c c - c 5' ggcgccg cgagc ugcucg cgggg ugcgugcc gc a ||||||| ||||| |||||| ||||| |||||||| || 3' ccguggc gcucg gcgagc gcccc acgcgcgg cg u a uu u u u a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR531a |
|
Accession | MIMAT0002887 |
Previous IDs | osa-miR531 |
Sequence |
18 - cucgccggggcugcgugccgccau - 41 |
Evidence | experimental; Northern [1] |
References |
|
1 |
PMID:16126864
"Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice"
Plant Physiol. 139:296-305(2005).
|