![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-514a-2 |
||||||||||
Accession | MI0003199 (change log) | |||||||||
Previous IDs | hsa-mir-514-2 | |||||||||
Symbol | HGNC:MIR514A2 | |||||||||
Description | Homo sapiens miR-514a-2 stem-loop | |||||||||
Gene family | MIPF0000130; mir-506 | |||||||||
Literature search |
![]()
9 open access papers mention hsa-mir-514a-2 | |||||||||
Stem-loop |
gu - g c - g a u aua 5' uguc ugug uac cuacuc ugga agug caauca gu a |||| |||| ||| |||||| |||| |||| |||||| || 3' acag acgc aug gaugag gucu ucac guuagu ua c -c u a a u - a u aau |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence hsa-miR-514a-5p |
|
Accession | MIMAT0022702 |
Sequence |
17 - uacucuggagagugacaaucaug - 39 |
Deep sequencing | 16176 reads, 81 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-514a-3p |
|
Accession | MIMAT0002883 |
Previous IDs | hsa-miR-514 |
Sequence |
54 - auugacacuucugugaguaga - 74 |
Deep sequencing | 604578 reads, 91 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|