![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-514a-1 |
||||||||||
Accession | MI0003198 (change log) | |||||||||
Previous IDs | hsa-mir-514-1 | |||||||||
Symbol | HGNC:MIR514A1 | |||||||||
Description | Homo sapiens miR-514a-1 stem-loop | |||||||||
Gene family | MIPF0000130; mir-506 | |||||||||
Literature search |
![]()
9 open access papers mention hsa-mir-514a-1 | |||||||||
Stem-loop |
aac u - g c - g a u aua 5' augu guc ugug uac cuacuc ugga agug caauca gu a |||| ||| |||| ||| |||||| |||| |||| |||||| || 3' ugca cag acgc aug gaugag gucu ucac guuagu ua u gca - u a a u - a u aau |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence hsa-miR-514a-5p |
|
Accession | MIMAT0022702 |
Sequence |
22 - uacucuggagagugacaaucaug - 44 |
Deep sequencing | 16176 reads, 81 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-514a-3p |
|
Accession | MIMAT0002883 |
Previous IDs | hsa-miR-514 |
Sequence |
59 - auugacacuucugugaguaga - 79 |
Deep sequencing | 604578 reads, 91 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|