Stem-loop sequence hsa-mir-513a-1

Accession

MI0003191 (change log)

Previous IDs

hsa-mir-513-1

Symbol

HGNC:MIR513A1

Description

Homo sapiens miR-513a-1 stem-loop

Gene family

MIPF0000130; mir-506

Literature search

46 open access papers mention hsa-mir-513a-1
(291 sentences)

Stem-loop

               uca  cauu  -  -     g        a   gg     uc        gaa 
5' gggaugccacau   gc    ca gc guaca ugccuuuc cag  aggug  auuuaugu   c
   ||||||||||||   ||    || || ||||| |||||||| |||  |||||  ||||||||    
3' cccuguggugua   cg    gu cg caugu augggaag guc  uccac  uaaauaua   u
               -ua  ucac  a  a     a        a   uu     uu        aaa 

Deep sequencing

4326 reads, 23.3 reads per million, 73 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 147213463-147213591 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR513A1
• HGNC:MIR513A1
• RNAcentral:URS000075E43A_9606
• miRBase Tracker:MI0003191

Mature sequence hsa-miR-513a-5p

• Accession: MIMAT0002877
• Previous IDs: hsa-miR-513;hsa-miR-513-5p
• Sequence: 37 - uucacagggaggugucau - 54
• Deep sequencing: 5754 reads, 64 experiments
• Evidence: experimental; array-cloned [1], cloned [2]
• Database links:
  • RNAcentral:URS0000357286_9606
• Predicted targets:
  • TargetMiner:hsa-miR-513a-5p
  • TargetScanVert:hsa-miR-513a-5p
  • miRDB:hsa-miR-513a-5p
  • microrna.org:hsa-miR-513a-5p

Mature sequence hsa-miR-513a-3p

• Accession: MIMAT0004777
• Previous IDs: hsa-miR-513-3p
• Sequence: 72 - uaaauuucaccuuucugagaagg - 94
• Deep sequencing: 2846 reads, 32 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00004BCE9B_9606
• Predicted targets:
  • TargetMiner:hsa-miR-513a-3p
  • TargetScanVert:hsa-miR-513a-3p
  • miRDB:hsa-miR-513a-3p
  • microrna.org:hsa-miR-513a-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).