![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-513a-1 |
|||||
Accession | MI0003191 (change log) | ||||
Previous IDs | hsa-mir-513-1 | ||||
Symbol | HGNC:MIR513A1 | ||||
Description | Homo sapiens miR-513a-1 stem-loop | ||||
Gene family | MIPF0000130; mir-506 | ||||
Literature search |
![]()
46 open access papers mention hsa-mir-513a-1 | ||||
Stem-loop |
uca cauu - - g a gg uc gaa 5' gggaugccacau gc ca gc guaca ugccuuuc cag aggug auuuaugu c |||||||||||| || || || ||||| |||||||| ||| ||||| |||||||| 3' cccuguggugua cg gu cg caugu augggaag guc uccac uaaauaua u -ua ucac a a a a uu uu aaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-513a-5p |
|
Accession | MIMAT0002877 |
Previous IDs | hsa-miR-513;hsa-miR-513-5p |
Sequence |
37 - uucacagggaggugucau - 54 |
Deep sequencing | 5754 reads, 64 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-513a-3p |
|
Accession | MIMAT0004777 |
Previous IDs | hsa-miR-513-3p |
Sequence |
72 - uaaauuucaccuuucugagaagg - 94 |
Deep sequencing | 2846 reads, 32 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|