Stem-loop sequence hsa-mir-502

AccessionMI0003186 (change log)
Symbol HGNC:MIR502
DescriptionHomo sapiens miR-502 stem-loop
Gene family MIPF0000139; mir-500
Literature search

21 open access papers mention hsa-mir-502
(40 sentences)

Stem-loop
   u             -         uau ug     uag   ugg 
5'  gcucccccucucu aauccuugc   c  ggugc   ugc   c
    ||||||||||||| |||||||||   |  |||||   |||   u
3'  cgagggggagaga uuaggaacg   g  ccacg   acg   c
   u             c         --- gu     -ua   uaa 
Get sequence
Deep sequencing
61093 reads, 58.7 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Extensive cloning studies suggest that the 3' product may be the predominant one [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 50014598-50014683 [+]
sense
OTTHUMT00000056562 ; CCNB3-005; intron 1
OTTHUMT00000056558 ; CCNB3-001; intron 1
OTTHUMT00000056559 ; CCNB3-002; intron 1
OTTHUMT00000056560 ; CCNB3-003; intron 1
OTTHUMT00000056561 ; CCNB3-004; intron 2
ENST00000491907 ; CCNB3-005; intron 1
ENST00000376042 ; CCNB3-001; intron 1
ENST00000376038 ; CCNB3-002; intron 1
ENST00000476167 ; CCNB3-003; intron 1
ENST00000493507 ; CCNB3-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-502
hsa-mir-500achrX: 50008431-50008514 [+]
hsa-mir-362chrX: 50008964-50009028 [+]
hsa-mir-501chrX: 50009722-50009805 [+]
hsa-mir-500bchrX: 50010672-50010750 [+]
hsa-mir-660chrX: 50013241-50013337 [+]
hsa-mir-502chrX: 50014598-50014683 [+]
Database links

Mature sequence hsa-miR-502-5p

Accession MIMAT0002873
Previous IDshsa-miR-502
Sequence

16 - 

auccuugcuaucugggugcua

 - 36

Get sequence
Deep sequencing5255 reads, 147 experiments
Evidence experimental; array-cloned [1]
Database links
Predicted targets

Mature sequence hsa-miR-502-3p

Accession MIMAT0004775
Sequence

52 - 

aaugcaccugggcaaggauuca

 - 73

Get sequence
Deep sequencing55833 reads, 155 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).