![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-502 |
||||||||||||||
Accession | MI0003186 (change log) | |||||||||||||
Symbol | HGNC:MIR502 | |||||||||||||
Description | Homo sapiens miR-502 stem-loop | |||||||||||||
Gene family | MIPF0000139; mir-500 | |||||||||||||
Literature search |
![]()
21 open access papers mention hsa-mir-502 | |||||||||||||
Stem-loop |
u - uau ug uag ugg 5' gcucccccucucu aauccuugc c ggugc ugc c ||||||||||||| ||||||||| | ||||| ||| u 3' cgagggggagaga uuaggaacg g ccacg acg c u c --- gu -ua uaa |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
Extensive cloning studies suggest that the 3' product may be the predominant one [2]. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence hsa-miR-502-5p |
|
Accession | MIMAT0002873 |
Previous IDs | hsa-miR-502 |
Sequence |
16 - auccuugcuaucugggugcua - 36 |
Deep sequencing | 5255 reads, 147 experiments |
Evidence | experimental; array-cloned [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-502-3p |
|
Accession | MIMAT0004775 |
Sequence |
52 - aaugcaccugggcaaggauuca - 73 |
Deep sequencing | 55833 reads, 155 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|