![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-520h |
||||||||||||||||||
Accession | MI0003175 (change log) | |||||||||||||||||
Symbol | HGNC:MIR520H | |||||||||||||||||
Description | Homo sapiens miR-520h stem-loop | |||||||||||||||||
Gene family | MIPF0000020; mir-515 | |||||||||||||||||
Literature search |
![]()
44 open access papers mention hsa-mir-520h | |||||||||||||||||
Stem-loop |
u u cc - uc guugu 5' uccca gc gugac ucuagagg aagcacuu uguuu c ||||| || ||||| |||||||| |||||||| ||||| u 3' agggu ug cauug agauuucc uucgugaa acaaa g u u -- c -- aaaga |
|||||||||||||||||
Deep sequencing |
| |||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||
Genome context |
|
|||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||
Database links |
Mature sequence hsa-miR-520h |
|
Accession | MIMAT0002867 |
Sequence |
55 - acaaagugcuucccuuuagagu - 76 |
Deep sequencing | 1558 reads, 62 experiments |
Evidence | experimental; array-cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|