Stem-loop sequence hsa-mir-520c

AccessionMI0003158 (change log)
Symbol HGNC:MIR520C
DescriptionHomo sapiens miR-520c stem-loop
Gene family MIPF0000020; mir-515
Literature search

62 open access papers mention hsa-mir-520c
(324 sentences)

Stem-loop 
           u  cg                       guug  u 
5' ucucaggc gu  uccucuagagggaagcacuuucu    uc g
   |||||||| ||  |||||||||||||||||||||||    || a
3' agaguuug ca  gggagauuuuccuucgugaaaga    ag a
           c  uu                       --aa  a
Get sequence
Deep sequencing
869 reads, 6.02 reads per million, 83 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53707453-53707539 [+]
sense
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 4
ENST00000597550 ; CTD-2245F17.3-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-520c
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
Database links

Mature sequence hsa-miR-520c-5p

Accession MIMAT0005455
Sequence

16 -  

cucuagagggaagcacuuucug

 - 37

Get sequence
Deep sequencing170 reads, 50 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-520c-3p

Accession MIMAT0002846
Previous IDshsa-miR-520c
Sequence

54 -  

aaagugcuuccuuuuagagggu

 - 75

Get sequence
Deep sequencing685 reads, 53 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).