![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-498 |
||||||||||||||||||
Accession | MI0003142 (change log) | |||||||||||||||||
Symbol | HGNC:MIR498 | |||||||||||||||||
Description | Homo sapiens miR-498 stem-loop | |||||||||||||||||
Gene family | MIPF0000463; mir-498 | |||||||||||||||||
Literature search |
![]()
21 open access papers mention hsa-mir-498 | |||||||||||||||||
Stem-loop |
aaccc -aag aag - - a c uaua 5' uccuuggg ug cucaggcuguga uuucaagc c ggggg guuuuuc a |||||||| || |||||||||||| |||||||| | ||||| ||||||| c 3' aggaaucu ac gaguuugacacu gaaguucg g ccucc cgaaaag u -uuga gcua -ga c a a a uagg |
|||||||||||||||||
Deep sequencing |
| |||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||
Genome context |
|
|||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||
Database links |
|
Mature sequence hsa-miR-498-5p |
|
Accession | MIMAT0002824 |
Sequence |
34 - uuucaagccagggggcguuuuuc - 56 |
Deep sequencing | 61 reads, 23 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-498-3p |
|
Accession | MIMAT0037323 |
Sequence |
70 - aaagcaccuccagagcuugaagc - 92 |
Deep sequencing | 37 reads, 20 experiments |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:25822230
"Selective microRNA-Offset RNA expression in human embryonic stem cells"
PLoS One. 10:e0116668(2015).
|