MIR511 is a type of MirRNA that is classified as one of the MirRNA targets in a study [PMC4877674]. It is largely expressed in the alimentary system and plays a role in response to stimulus [PMC8369952]. The interactions between Adh6-ps1, Mir455, and MIR511 are important to understand because they may contribute to the understanding of hepatocellular carcinoma (HCC) [PMC8369952]. Mir455 and MIR511 were found to be downregulated in diethylnitrosamine chemically induced HCC in a rat model [PMC8369952]. The activation of the notch signaling pathway, which plays a role in liver development, lipid metabolism, and lipogenesis, was also reported in the same HCC rat model [PMC8369952'>PMC8369952]. Adh6-ps1 is moderately expressed in HCC, and its association with Mir455 and MIR511 suggests that it may have a secondary role in tumorigenesis and disease phenotypes [PMC8369952]. Mir361 is implicated specifically in endometrial cancers, while Mir455 is associated with HCC as well as gastric cancer (GC) and colorectal cancer (CRC) [PMC8369952]. The limited number of wheat EST sequences available may have contributed to the inability to predict targets for MIR511 among other new miRNAs studied [PMC2394755]. DEGs were found to target motifs of microRNAs including MIR511 [PMC8901935]. miR30a upregulation attenuates Bcl2 and Bax protein after irradiation while MIR511 can enhance Bax to block the growth of radiotherapy-resistant A549 cells. Knockdown of miR95 speeds up irradiation-induced apoptosis with an increase in caspase 3/9 levels and reduction in Bcl2 levels. Other mechanisms are also involved in miRNA-mediated apoptosis [PMC6525830].
a ac cG C G g ua caau gac ccau UGUCUUUUGCU UGCA UCA uaaa u |||| ||| |||| ||||||||||| |||| ||| |||| guua cug ggua ACAGAAAACGA GUGU Agu guuu u c gu AG U A - uu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002808 |
Description | Homo sapiens hsa-miR-511-5p mature miRNA |
Sequence | 16 - GUGUCUUUUGCUCUGCAGUCA - 36 |
Evidence |
experimental
array-cloned [1], Illumina [2] |
Accession | MIMAT0026606 |
Description | Homo sapiens hsa-miR-511-3p mature miRNA |
Sequence | 54 - AAUGUGUAGCAAAAGACAGA - 73 |
Evidence |
experimental
Illumina [2] |
Database links | |
Predicted targets |
|