Stem-loop sequence hsa-mir-488

Accession

MI0003123 (change log)

Symbol

HGNC:MIR488

Description

Homo sapiens miR-488 stem-loop

Gene family

MIPF0000318; mir-488

Literature search

28 open access papers mention hsa-mir-488
(167 sentences)

Stem-loop

       a      cu  c   u      a  c        guu 
5' gaga ucaucu  cc aga aauggc cu ucaaacaa   u
   |||| ||||||  || ||| |||||| || ||||||||   c
3' cucu aguaga  gg ucu uuaucg ga aguuuguu   c
       c      cu  u   -      -  a        aaa 

Deep sequencing

1836 reads, 16.3 reads per million, 92 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-488-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 177029363-177029445 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000084823 ; ASTN1-002; intron 2

  OTTHUMT00000084822 ; ASTN1-001; intron 2

  OTTHUMT00000084824 ; ASTN1-003; intron 2

  OTTHUMT00000386134 ; ASTN1-006; intron 2

  ENST00000367657 ; ASTN1-002; intron 2

  ENST00000361833 ; ASTN1-001; intron 2

  ENST00000424564 ; ASTN1-003; intron 2

  ENST00000281881 ; ASTN1-006; intron 2

  ENST00000367654 ; ASTN1-201; intron 2

Database links

• EntrezGene:MIR488
• HGNC:MIR488
• RNAcentral:URS000072C8C2_9606
• miRBase Tracker:MI0003123

Mature sequence hsa-miR-488-5p

• Accession: MIMAT0002804
• Previous IDs: hsa-miR-488;hsa-miR-488*
• Sequence: 14 - cccagauaauggcacucucaa - 34
• Deep sequencing: 218 reads, 47 experiments
• Evidence: experimental; array-cloned [1]
• Predicted targets:
  • TargetMiner:hsa-miR-488-5p
  • TargetScanVert:hsa-miR-488-5p
  • miRDB:hsa-miR-488-5p
  • microrna.org:hsa-miR-488-5p

Mature sequence hsa-miR-488-3p

• Accession: MIMAT0004763
• Previous IDs: hsa-miR-488
• Sequence: 52 - uugaaaggcuauuucuugguc - 72
• Deep sequencing: 1617 reads, 85 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00001BCAC5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-488-3p
  • TargetScanVert:hsa-miR-488-3p
  • miRDB:hsa-miR-488-3p
  • microrna.org:hsa-miR-488-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).