Stem-loop sequence ssc-mir-128-1

Accession

MI0002451 (change log)

Previous IDs

ssc-mir-128a;ssc-mir-128

Description

Sus scrofa miR-128-1 stem-loop

Gene family

MIPF0000048; mir-128

Literature search

9 open access papers mention ssc-mir-128-1
(14 sentences)

Stem-loop

   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 

Deep sequencing

573 reads, 6.67 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr15: 18661614-18661695 [-]
• Overlapping transcripts:

  sense

  ENSSSCT00000017092 ; R3HDM1-201; intron 18

Database links

• EntrezGene:MIR128
• miRBase Tracker:MI0002451

Mature sequence ssc-miR-128

• Accession: MIMAT0002157
• Previous IDs: ssc-miR-128a
• Sequence: 50 - ucacagugaaccggucucuuu - 70
• Deep sequencing: 1386 reads, 15 experiments
• Evidence: experimental; Illumina [1-3]

References

1. PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2. PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).