Stem-loop sequence ssc-mir-15b

Accession

MI0002419 (change log)

Description

Sus scrofa miR-15b stem-loop

Gene family

MIPF0000006; mir-15

Literature search

16 open access papers mention ssc-mir-15b
(32 sentences)

Stem-loop

   u    --g       gua   u       c  c      ua   a  ac 
5'  ugag   ccuuaaa   cug agcagca au augguu  cau cu  a
    ||||   |||||||   ||| ||||||| || ||||||  ||| ||  a
3'  acuu   ggaauuu   gau ucgucgu ua uacuaa  gua ga  u
   u    aaa       aaa   c       u  u      gc   -  ac 

Deep sequencing

1867 reads, 180 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr13: 108388133-108388230 [+]
• Overlapping transcripts:

  sense

  ENSSSCT00000012842 ; SMC4-201; intron 5

Clustered miRNAs

< 10kb from ssc-mir-15b

• ssc-mir-15b: chr13: 108388133-108388230 [+]
• ssc-mir-16-1: chr13: 108388290-108388366 [+]

Database links

• EntrezGene:MIR15B
• miRBase Tracker:MI0002419

Mature sequence ssc-miR-15b

• Accession: MIMAT0002125
• Sequence: 20 - uagcagcacaucaugguuuaca - 41
• Deep sequencing: 1766 reads, 15 experiments
• Evidence: experimental; cloned [2,4], Illumina [3,5-6]

References

1. PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2. PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
3. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).