Stem-loop sequence sbi-MIR167a

AccessionMI0001513 (change log)
DescriptionSorghum bicolor miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention sbi-MIR167a
(6 sentences)

Stem-loop
   u  a      --             ucuga u       -    aaga 
5'  ga gcugcc  agcaugaucuagc     g gaucacc cgag    a
    || ||||||  |||||||||||||     | ||||||| ||||    c
3'  cu cgacgg  ucguacuggaucg     c cuggugg gcuu    a
   a  c      cg             uuccg u       a    gaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 4354010-4354105 [+]
intergenic
Database links

Mature sequence sbi-miR167a

Accession MIMAT0001407
Sequence

1 - 

ugaagcugccagcaugaucua

 - 21

Get sequence
Evidence by similarity; MI0000209

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).