Stem-loop sequence sbi-MIR156c

AccessionMI0001505 (change log)
DescriptionSorghum bicolor miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sbi-MIR156c
(25 sentences)

Stem-loop
   u      -     -        a      gccu   uu      ugaau 
5'  gacaga agaga gugagcac cauggu    uuc  gcauga     g
    |||||| ||||| |||||||| ||||||    |||  ||||||     a
3'  cugucu ucucu cacucgug guaucg    aag  cguacu     g
   a      c     u        c      ----   cu      uaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 3416227-3416321 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR156c
sbi-MIR156cchr3: 3416227-3416321 [-]
sbi-MIR156bchr3: 3415906-3415989 [-]
Database links

Mature sequence sbi-miR156c

Accession MIMAT0001399
Sequence

1 - 

ugacagaagagagugagcac

 - 20

Get sequence
Evidence by similarity; MI0000182

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).