Stem-loop sequence dre-mir-210

Accession

MI0001379 (change log)

Description

Danio rerio miR-210 stem-loop

Gene family

MIPF0000086; mir-210

Literature search

5 open access papers mention dre-mir-210
(13 sentences)

Stem-loop

   gca   a    a   acua       u  cgccuau 
5'    ggu agcc cug    acgcaca ug       u
      ||| |||| |||    ||||||| ||        
3'    cca ucgg gac    ugcgugu ac       c
   -ga   a    c   agug       c  cucaccu 

Deep sequencing

3937 reads, 45.5 reads per million, 11 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Lim et al. cloned this miRNA from D. rerio [1]. The 3' end of the mature sequence was not determined, but was later analysed in a study of many clones in mouse [2]. The most common cloned length is shown here.

Genome context

• Coordinates (GRCz11; GCA_000002035.4): chr25: 25506483-25506555 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:mir210
• EntrezGene:mir210
• RNAcentral:URS000075EE3A_7955
• miRBase Tracker:MI0001379

Mature sequence dre-miR-210-5p

• Accession: MIMAT0003392
• Previous IDs: dre-miR-210*
• Sequence: 8 - agccacugacuaacgcacauug - 29
• Deep sequencing: 485 reads, 10 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS00001F46C7_7955

Mature sequence dre-miR-210-3p

• Accession: MIMAT0001281
• Previous IDs: dre-miR-210
• Sequence: 48 - cugugcgugugacagcggcuaa - 69
• Deep sequencing: 3450 reads, 11 experiments
• Evidence: experimental; cloned [1,3]
• Database links:
  • RNAcentral:URS00005D32A0_7955
• Predicted targets:
  • TargetScanFish:dre-miR-210

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).