![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-101-1 |
|||||
Accession | MI0001270 (change log) | ||||
Previous IDs | gga-mir-101 | ||||
Description | Gallus gallus miR-101 stem-loop | ||||
Gene family | MIPF0000046; mir-101 | ||||
Literature search |
![]()
14 open access papers mention gga-mir-101-1 | ||||
Stem-loop |
c cg guaua 5' acuauc uuuuucgguuaucaugguac gugcu c |||||| |||||||||||||||||||| ||||| 3' uggugg aagaagucaauagugucaug caugg g u -a aaagu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gga-miR-101-1-5p |
|
Accession | MIMAT0026545 |
Sequence |
12 - ucgguuaucaugguaccggugcu - 34 |
Deep sequencing | 114 reads, 5 experiments |
Evidence | experimental; Illumina [3] |
Predicted targets |
|
Mature sequence gga-miR-101-3p |
|
Accession | MIMAT0001185 |
Sequence |
48 - guacaguacugugauaacugaa - 69 |
Deep sequencing | 4095283 reads, 5 experiments |
Evidence | experimental; cloned [1], Illumina [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
2 |
"
Unpublished.
|
3 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
4 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|
5 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|
6 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|