Stem-loop sequence gga-mir-30c-1

Accession

MI0001257 (change log)

Description

Gallus gallus miR-30c-1 stem-loop

Gene family

MIPF0000005; mir-30

Literature search

21 open access papers mention gga-mir-30c-1
(63 sentences)

Stem-loop

   a     cu    cac         -    aca        ug gaa 
5'  ccaug  guag   guguaaaca uccu   cucucagc  u   c
    |||||  ||||   ||||||||| ||||   ||||||||  |   u
3'  gguac  cguc   cgcauuugu agga   gagggucg  g   c
   a     --    uuc         u    ---        gu gag 

Deep sequencing

178564 reads, 1.98e+03 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr23: 4947355-4947443 [+]
• Overlapping transcripts:

  sense

  ENSGALT00000035036 ; NFYC-201; intron 4

Clustered miRNAs

< 10kb from gga-mir-30c-1

• gga-mir-30e: chr23: 4946132-4946227 [+]
• gga-mir-30c-1: chr23: 4947355-4947443 [+]

Database links

• EntrezGene:
• RNAcentral:URS000075C3F2_9031
• miRBase Tracker:MI0001257

Mature sequence gga-miR-30c-5p

• Accession: MIMAT0001137
• Sequence: 17 - uguaaacauccuacacucucagcu - 40
• Deep sequencing: 265112 reads, 5 experiments
• Evidence: experimental; cloned [2-3], Northern [2], Illumina [4]
• Database links:
  • RNAcentral:URS00000980C2_9031
• Predicted targets:
  • TargetScanVert:gga-miR-30c-5p
  • miRDB:gga-miR-30c-5p

Mature sequence gga-miR-30c-1-3p

• Accession: MIMAT0031105
• Sequence: 57 - ugggagaggauuguuuacgcc - 77
• Deep sequencing: 45970 reads, 5 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS000075C5B4_9031
• Predicted targets:
  • TargetScanVert:gga-miR-30c-1-3p
  • miRDB:gga-miR-30c-1-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4. " McBride D, Carre W, Law A, Clinton M Unpublished.
5. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
6. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).