Stem-loop sequence gga-mir-140

Accession

MI0001229 (change log)

Description

Gallus gallus miR-140 stem-loop

Gene family

MIPF0000085; mir-140

Literature search

13 open access papers mention gga-mir-140
(72 sentences)

Stem-loop

   ugcgucu     -       -  a             a       uu   uc 
5'        cuccg uguccug cc gugguuuuacccu ugguagg  acg  a
          ||||| ||||||| || ||||||||||||| |||||||  |||   
3'        ggggc guagggc gg caccaagauggga accaucu  ugu  u
   ------c     c       a  -             c       --   cg 

Deep sequencing

981478 reads, 1.19e+04 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr11: 19310301-19310395 [+]
• Overlapping transcripts:

  sense

  ENSGALT00000000991 ; WWP2-201; intron 16

Database links

• EntrezGene:
• RNAcentral:URS000075DA0D_9031
• miRBase Tracker:MI0001229

Mature sequence gga-miR-140-5p

• Accession: MIMAT0001159
• Previous IDs: gga-miR-140
• Sequence: 22 - agugguuuuacccuaugguag - 42
• Deep sequencing: 84637 reads, 5 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS00002197CF_9031
• Predicted targets:
  • TargetScanVert:gga-miR-140-5p
  • miRDB:gga-miR-140-5p

Mature sequence gga-miR-140-3p

• Accession: MIMAT0003722
• Previous IDs: gga-miR-140*
• Sequence: 62 - ccacaggguagaaccacggac - 82
• Deep sequencing: 896830 reads, 5 experiments
• Evidence: experimental; cloned [2], Northern [2]
• Database links:
  • RNAcentral:URS000075E19C_9031
• Predicted targets:
  • TargetScanVert:gga-miR-140-3p
  • miRDB:gga-miR-140-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4. " McBride D, Carre W, Law A, Clinton M Unpublished.
5. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).