Stem-loop sequence gga-mir-30c-2

AccessionMI0001205 (change log)
DescriptionGallus gallus miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

21 open access papers mention gga-mir-30c-2
(62 sentences)

Stem-loop 
      uacu       u   aca         ----gu g 
5' agg    guaaaca ccu   cucucagcu      g a
   |||    ||||||| |||   |||||||||      |  
3' ucc    cauuugu gga   gagggucga      c a
      cucu       c   --a         aagaau a
Get sequence
Deep sequencing
151090 reads, 1.68e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 82653698-82653769 [+]
intergenic
Database links

Mature sequence gga-miR-30c-5p

Accession MIMAT0001137
Sequence

7 -  

uguaaacauccuacacucucagcu

 - 30

Get sequence
Deep sequencing265112 reads, 5 experiments
Evidence experimental; cloned [2-3], Northern [2], Illumina [4]
Database links
Predicted targets

Mature sequence gga-miR-30c-2-3p

Accession MIMAT0026515
Sequence

48 -  

ugggagaaggcuguuuacucu

 - 68

Get sequence
Deep sequencing18442 reads, 5 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
" McBride D, Carre W, Law A, Clinton M Unpublished.
5
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
6
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).