Stem-loop sequence gga-mir-26a

Accession

MI0001187 (change log)

Description

Gallus gallus miR-26a stem-loop

Gene family

MIPF0000043; mir-26

Literature search

21 open access papers mention gga-mir-26a
(145 sentences)

Stem-loop

      a  ug  u         c          -   ucc 
5' guc cc  gu caaguaauc aggauaggcu gua   a
   ||| ||  || ||||||||| |||||||||| |||    
3' cgg gg  ca guucauugg ucuuauccgg cgu   u
      a  gu  c         u          u   ccu 

Deep sequencing

846764 reads, 9.4e+03 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr2: 4575294-4575370 [+]
• Overlapping transcripts:

  sense

  ENSGALT00000042703 ; NFI1-201; intron 5

  ENSGALT00000009158 ; NFI1-202; intron 5

Database links

• EntrezGene:
• RNAcentral:URS000075B2CB_9031
• miRBase Tracker:MI0001187

Mature sequence gga-miR-26a-5p

• Accession: MIMAT0001118
• Sequence: 10 - uucaaguaauccaggauaggc - 30
• Deep sequencing: 846611 reads, 5 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS000000E09E_9031
• Predicted targets:
  • TargetScanVert:gga-miR-26a-5p
  • miRDB:gga-miR-26a-5p

Mature sequence gga-miR-26a-3p

• Accession: MIMAT0026501
• Sequence: 49 - ccuauucuugguuacuugcacug - 71
• Deep sequencing: 152 reads, 5 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:gga-miR-26a-3p
  • miRDB:gga-miR-26a-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.
4. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).