Stem-loop sequence gga-mir-222a

Accession

MI0001177 (change log)

Previous IDs

gga-mir-222a;gga-mir-222;gga-mir-222-1

Description

Gallus gallus miR-222a stem-loop

Gene family

MIPF0000051; mir-221

Literature search

18 open access papers mention gga-mir-222a
(161 sentences)

Stem-loop

   -----  u  u  cc     auc             -     auu   ucuu 
5'      ug ag ug  cauca   gcucaguagucag uguag   cug    u
        || || ||  |||||   ||||||||||||| |||||   |||     
3'      ac uc ac  guagu   ugggucaucgguc acauc   gac    a
   ucuau  -  u  -a     cuc             u     gac   uaac 

Deep sequencing

49632 reads, 300 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr1: 110650030-110650127 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from gga-mir-222a

• gga-mir-222a: chr1: 110650030-110650127 [+]
• gga-mir-221: chr1: 110650534-110650632 [+]

Database links

• EntrezGene:
• RNAcentral:URS0000759A48_9031
• miRBase Tracker:MI0001177

Mature sequence gga-miR-222

• Accession: MIMAT0001107
• Sequence: 57 - agcuacaucuggcuacugggucuc - 80
• Deep sequencing: 81242 reads, 5 experiments
• Evidence: experimental

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.
4. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).