![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR398c |
||||||
Accession | MI0001019 (change log) | |||||
Description | Arabidopsis thaliana miR398c stem-loop | |||||
Gene family | MIPF0000107; MIR398 | |||||
Literature search |
![]()
30 open access papers mention ath-MIR398c | |||||
Stem-loop |
u u a u a ----- caaucaac a --- 5' gga cucg caggg ugau ugagaacac acgag ggcu uaac gacgc ||| |||| ||||| |||| ||||||||| ||||| |||| |||| |||| u 3' ucu gagu guccc acug acucuugug ugcuc ucga auug cugca u c c c g uacuu -------- c uua |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ath-miR398c-5p |
|
Accession | MIMAT0031912 |
Sequence |
12 - aggguugauaugagaacacac - 32 |
Evidence | not experimental |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|