Stem-loop sequence ath-MIR398c

Accession

MI0001019 (change log)

Description

Arabidopsis thaliana miR398c stem-loop

Gene family

MIPF0000107; MIR398

Literature search

30 open access papers mention ath-MIR398c
(122 sentences)

Stem-loop

   u   u    a     u    a         -----     caaucaac    a    ---      
5'  gga cucg caggg ugau ugagaacac     acgag        ggcu uaac   gacgc 
    ||| |||| ||||| |||| |||||||||     |||||        |||| ||||   |||| u
3'  ucu gagu guccc acug acucuugug     ugcuc        ucga auug   cugca 
   u   c    c     c    g         uacuu     --------    c    uua      

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr5: 4694694-4694808 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR398c

• ath-MIR398b: chr5: 4691022-4691137 [+]
• ath-MIR398c: chr5: 4694694-4694808 [+]

Database links

• RNAcentral:URS0000653FAB_3702
• miRBase Tracker:MI0001019

Mature sequence ath-miR398c-5p

• Accession: MIMAT0031912
• Sequence: 12 - aggguugauaugagaacacac - 32
• Evidence: not experimental

Mature sequence ath-miR398c-3p

• Accession: MIMAT0000950
• Previous IDs: ath-miR398c
• Sequence: 85 - uguguucucaggucaccccug - 105
• Evidence: experimental; 5'RACE [1,3], Northern [1-2], PCR [1], cloned [2-3], 454 [4-5], MPSS [4]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).