miRBase entry: ath-MIR397a

Stem-loop ath-MIR397a


Accession
MI0001015
Description
Arabidopsis thaliana ath-MIR397a precursor miRNA
Gene family
MIPF0000120; MIR397

Literature search
11 open access papers mention ath-MIR397a
(40 sentences)

Sequence

ugaaugaacaUCAUUGAGUGCAGCGUUGAUGuaauuucguuuuguuuuucauuguugaauggauuaaaagaauuuauaccagcguugcgcucaauuauguuuuucua
.(((.((((((.((((((((((((((((.(((((.(((.(((((...((((((....)))))).)))))))).))))).)))))))))))))))).)))))))))..

Structure
-u   u      C                A     u   g     uuu      g 
  gaa gaacaU AUUGAGUGCAGCGUUG UGuaa uuc uuuug   uucauu u
  ||| |||||| |||||||||||||||| ||||| ||| |||||   ||||||  
  cuu uuugua uaacucgcguugcgac auauu aag aaaau   agguaa u
au   -      u                c     u   -     --u      g 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence belongs to the miR397 family of miRNAs, which are predicted to target mRNAs coding for laccases and beta-6 tubulin [1].

Genome context
chr4: 2625950-2626056 [+]

Database links

Mature ath-miR397a

Accession MIMAT0000946
Description Arabidopsis thaliana ath-miR397a mature miRNA
Sequence 11 - UCAUUGAGUGCAGCGUUGAUG - 31
Evidence experimental
5'RACE [1], PCR [1], cloned [2-3], 454 [4-5]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799

  5. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019