miRBase entry: ath-MIR395d

Stem-loop ath-MIR395d


Accession
MI0001010
Description
Arabidopsis thaliana ath-MIR395d precursor miRNA
Gene family
MIPF0000016; MIR395

Literature search
25 open access papers mention ath-MIR395d
(106 sentences)

Sequence

auguccucuagaguucuccugaacacuucauuggaaauuuguuauucaguaagcuaacaguuaauuccaCUGAAGUGUUUGGGGGAACUCccgaugucau
(((.(.((..((((((((((((((((((((.(((((..((((((..........))))))....))))).))))))))))))))))))))..)).).)))

Structure
   u c  ua                    u     --au      uuca 
aug c uc  gaguucuccugaacacuuca uggaa    uuguua    g
||| | ||  |||||||||||||||||||| |||||    ||||||     
uac g ag  CUCAAGGGGGUUUGUGAAGU accuu    gacaau    u
   u u  cc                    C     aauu      cgaa 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1].

Genome context
chr1: 26269979-26270078 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from ath-MIR395d
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ath-miR395d

Accession MIMAT0000941
Description Arabidopsis thaliana ath-miR395d mature miRNA
Sequence 70 - CUGAAGUGUUUGGGGGAACUC - 90
Evidence experimental
5'RACE [1], Northern [1], PCR [1], MPSS [2], 454 [3], Illumina [4]

References

  1. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  2. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  3. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  4. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799