Stem-loop ath-MIR169d

Accession

MI0000978

Description

Arabidopsis thaliana ath-MIR169d precursor miRNA

Gene family

MIPF0000037; MIR169_2

Literature search

34 open access papers mention ath-MIR169d
(163 sentences)

Sequence

guaucauagagucuugcauggaaaaauuaaagaaugagauUGAGCCAAGGAUGACUUGCCGauguuaucaacaaaucuuaacugauuuugguguccggcaaguugaccuuggcucuguuuccuucuuuucuuuucaaugucaaacucuagauau
(((((.((((((.((((((.(((((...((((((.(((((.(((((((((..(((((((((....((((((..((((......))))))))))..)))))))))..))))))))).))))).))))))..))))).))).))))))))))))))

Structure

     a      c   -   g     auu      u     U         AU         augu      ca    uu 
guauc uagagu uug cau gaaaa   aaagaa gagau GAGCCAAGG  GACUUGCCG    uaucaa  aauc  a
||||| |||||| ||| ||| |||||   |||||| ||||| |||||||||  |||||||||    ||||||  ||||   
uauag aucuca aac gua cuuuu   uuucuu cuuug cucgguucc  uugaacggc    gugguu  uuag  a
     -      -   u   a     -cu      c     u         ag         --cu      --    uc 

Annotation confidence Not enough data

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

chr1: 20039463-20039616 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from ath-MIR169d

Mature ath-miR169d

• Accession: MIMAT0000908
• Description: Arabidopsis thaliana ath-miR169d mature miRNA
• Sequence: 41 - UGAGCCAAGGAUGACUUGCCG - 61
• Evidence: experimental ; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799