![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-376a-1 |
||||||||||||||||||||||||||||||||||
Accession | MI0000784 (change log) | |||||||||||||||||||||||||||||||||
Previous IDs | hsa-mir-376a | |||||||||||||||||||||||||||||||||
Symbol | HGNC:MIR376A1 | |||||||||||||||||||||||||||||||||
Description | Homo sapiens miR-376a-1 stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000091; mir-368 | |||||||||||||||||||||||||||||||||
Literature search |
![]()
80 open access papers mention hsa-mir-376a-1 | |||||||||||||||||||||||||||||||||
Stem-loop |
u g a c u --gua u 5' aaaa gu gauu uccu cuauga cau a |||| || |||| |||| |||||| ||| u 3' uuuu ca cuaa agga gauacu gua u c g c a - aauua u |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||
Comments |
The mature miR-376a products have been shown to be modified by A to I edits [3]. |
|||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-376a-5p |
|
Accession | MIMAT0003386 |
Previous IDs | hsa-miR-376a* |
Sequence |
7 - guagauucuccuucuaugagua - 28 |
Deep sequencing | 5733 reads, 110 experiments |
Evidence | experimental; cloned [2,4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-376a-3p |
|
Accession | MIMAT0000729 |
Previous IDs | hsa-miR-376a |
Sequence |
44 - aucauagaggaaaauccacgu - 64 |
Deep sequencing | 38783 reads, 132 experiments |
Evidence | experimental; cloned [1,3], SOLiD [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17322061
"Redirection of silencing targets by adenosine-to-inosine editing of miRNAs"
Science. 315:1137-1140(2007).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|