miRBase entry: cel-mir-359

Stem-loop cel-mir-359


Accession
MI0000758
Description
Caenorhabditis elegans cel-mir-359 precursor miRNA
Gene family
MIPF0000371; mir-359

Literature search
1 open access papers mention cel-mir-359
(1 sentences)

Sequence

635 reads, 41 reads per million, 12 experiments
aaugcuccuugaaauuucaaucguuagaguaacacacaguuacacgaccucaucaaucgugUCACUGGUCUUUCUCUGACGAAuugaaguucuggagacaauuuugguug
..((((((..(((.(((((((((((((((.((.((.((((.((((((.........)))))).)))))).)).)))))))).)))))))))).)))).))..........

Structure
--------aa  -    uu   a       -        u  c  a    u      ccu 
          ug cucc  gaa uuucaau cguuagag aa ac cagu acacga   c
          || ||||  ||| ||||||| |||||||| || || |||| ||||||   a
          ac gagg  cuu gaaguuA GCAGUCUC UU UG GUCA Ugugcu   u
guugguuuua  a    -u   -       A        U  C  -    C      aac 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
chrX: 3004291-3004400 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from cel-mir-359
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-359

Accession MIMAT0000701
Description Caenorhabditis elegans cel-miR-359 mature miRNA
Sequence 62 - UCACUGGUCUUUCUCUGACGAA - 83
Evidence experimental
cloned [1-2], PCR [1], Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  2. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  3. PubMed ID: 15317971
    Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification
    "Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB"
    "RNA (2004) 10:1309-1322