Stem-loop cel-mir-357

Accession

MI0000756

Description

Caenorhabditis elegans cel-mir-357 precursor miRNA

Gene family

MIPF0000227; mir-357

Literature search

1 open access papers mention cel-mir-357
(4 sentences)

Sequence

1221 reads, 20 reads per million, 13 experiments

acgcuguacuacucaccagcggauCCCUACAACGCUGCGCAUAUGCaugaacacaaugaaaauguAAAUGCCAGUCGUUGCAGGAGUucgcauacaguaguaaaaugcgc
.(((..(((((((.....((((((.(((.((((((((.((((.(((((.............))))).))))))).))))).))).))))))....)))))))....))).

Structure

a   --ug       cacca      C   A     -   C    A     gaaca 
 cgc    uacuacu     gcggau CCU CAACG CUG GCAU UGCau     c
 |||    |||||||     |||||| ||| ||||| ||| |||| |||||     a
 gcg    augauga     cgcuUG GGA GUUGC GAC CGUA Augua     a
c   uaaa       -caua      A   C     U   -    A     aaagu 

Annotation confidence Not enough data

Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context

chrV: 8580542-8580651 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from cel-mir-357

Mature cel-miR-357-3p

• Accession: MIMAT0000699
• Description: Caenorhabditis elegans cel-miR-357-3p mature miRNA
• Sequence: 66 - AAAUGCCAGUCGUUGCAGGAGU - 87
• Evidence: experimental ; cloned [1-2], PCR [1], Illumina [3,5], CLIPseq [4]

Mature cel-miR-357-5p

• Accession: MIMAT0020343
• Description: Caenorhabditis elegans cel-miR-357-5p mature miRNA
• Sequence: 25 - CCCUACAACGCUGCGCAUAUGC - 46
• Evidence: experimental ; Illumina [5]

References

1. PubMed ID: 17174894
   Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
   "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
   "Cell (2006) 127:1193-1207


2. PubMed ID: 19460142
   Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
   Kato M, de Lencastre A, Pincus Z, Slack FJ
   Genome Biol (2009) 10:R54


3. PubMed ID: 20062054
   Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
   "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
   "Nat Struct Mol Biol (2010) 17:173-179


4. PubMed ID: 15317971
   Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification
   "Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB"
   "RNA (2004) 10:1309-1322


5. PubMed ID: 21307183
   Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
   "Warf MB, Johnson WE, Bass BL"
   "RNA (2011) 17:563-577