Stem-loop sequence hsa-mir-30c-1

Accession

MI0000736 (change log)

Symbol

HGNC:MIR30C1

Description

Homo sapiens miR-30c-1 stem-loop

Gene family

MIPF0000005; mir-30

Literature search

384 open access papers mention hsa-mir-30c-1
(1793 sentences)

Stem-loop

   a     cu    ugu u       u   aca         ---g  a 
5'  ccaug  guag   g guaaaca ccu   cucucagcu    ug g
    |||||  ||||   | ||||||| |||   |||||||||    ||  
3'  gguac  cguc   c cauuugu ggg   gagggucgg    ac c
   a     --    uuc u       u   --a         ugga  u 

Deep sequencing

1413073 reads, 3.21e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MI0000736) and 6 (MI0000254) [3]. Expression of miR-30c was later validated in human HL-60 leukemia cells [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 40757284-40757372 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000319380 ; ZMPSTE24-004; intron 1

  OTTHUMT00000015766 ; ZMPSTE24-001; intron 9

  ENST00000474142 ; ZMPSTE24-004; intron 1

  ENST00000372759 ; ZMPSTE24-001; intron 9

Clustered miRNAs

< 10kb from hsa-mir-30c-1

• hsa-mir-30e: chr1: 40754355-40754446 [+]
• hsa-mir-30c-1: chr1: 40757284-40757372 [+]

Database links

• EntrezGene:MIR30C1
• HGNC:MIR30C1
• RNAcentral:URS000075D43C_9606
• miRBase Tracker:MI0000736

Mature sequence hsa-miR-30c-5p

• Accession: MIMAT0000244
• Previous IDs: hsa-miR-30c
• Sequence: 17 - uguaaacauccuacacucucagc - 39
• Deep sequencing: 2809908 reads, 159 experiments
• Evidence: experimental; cloned [2,4-6]
• Database links:
  • RNAcentral:URS000019907A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30c-5p
  • TargetScanVert:hsa-miR-30c-5p
  • miRDB:hsa-miR-30c-5p
  • microrna.org:hsa-miR-30c-5p

Mature sequence hsa-miR-30c-1-3p

• Accession: MIMAT0004674
• Previous IDs: hsa-miR-30c-1*
• Sequence: 56 - cugggagaggguuguuuacucc - 77
• Deep sequencing: 8434 reads, 156 experiments
• Evidence: experimental; cloned [5]
• Database links:
  • RNAcentral:URS0000237FB8_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30c-1-3p
  • TargetScanVert:hsa-miR-30c-1-3p
  • miRDB:hsa-miR-30c-1-3p
  • microrna.org:hsa-miR-30c-1-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).