![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-214 |
||||||
Accession | MI0000698 (change log) | |||||
Symbol | MGI:Mir214 | |||||
Description | Mus musculus miR-214 stem-loop | |||||
Gene family | MIPF0000062; mir-214 | |||||
Literature search |
![]()
120 open access papers mention mmu-mir-214 | |||||
Stem-loop |
ggccu acaga u aca aacau 5' ggcugg guugucaugug cugccugucu cuugcugugcag c |||||| ||||||||||| |||||||||| |||||||||||| c 3' ccgacc caacaguacac gacggacaga ggacgacauguc g ----u ----- u cac cacuc |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Mouse mir-214 is predicted [2] based on homology to a reported miR from human (MI0000290) [1]. Its expression was later verified by cloning [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-214-5p |
|
Accession | MIMAT0004664 |
Previous IDs | mmu-miR-214* |
Sequence |
30 - ugccugucuacacuugcugugc - 51 |
Deep sequencing | 41028 reads, 69 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-214-3p |
|
Accession | MIMAT0000661 |
Previous IDs | mmu-miR-214 |
Sequence |
71 - acagcaggcacagacaggcagu - 92 |
Deep sequencing | 93861 reads, 87 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|