Accession | MIMAT0004664 |
Description | mmu-miR-214-5p mature miRNA |
Hairpins | |
Sequence | UGCCUGUCUACACUUGCUGUGC |
Evidence |
experimental
cloned [3], Illumina [4-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:1903243 negative regulation of cardiac muscle hypertrophy in response to stress |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27162619 | occurs_in UBERON:0003101 |