![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-107 |
|||||
Accession | MI0000684 (change log) | ||||
Symbol | MGI:Mir107 | ||||
Description | Mus musculus miR-107 stem-loop | ||||
Gene family | MIPF0000024; mir-103 | ||||
Literature search |
![]()
89 open access papers mention mmu-mir-107 | ||||
Stem-loop |
- --c u u c u a 5' uucucugugcuuu agcu cu uacaguguugc uug ggc u ||||||||||||| |||| || ||||||||||| ||| ||| g 3' gagagacacgaaa ucgg ga auguuacgacg aac uug g c cua - c - - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Mouse mir-107 is predicted [2] based on homology to a cloned miR from human (MI0000114) [1], and later verified in mouse [3,4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-107-5p |
|
Accession | MIMAT0017048 |
Previous IDs | mmu-miR-107* |
Sequence |
15 - agcuucuuuacaguguugccuug - 37 |
Deep sequencing | 842 reads, 86 experiments |
Evidence | experimental; 454 [6], Illumina [7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-107-3p |
|
Accession | MIMAT0000647 |
Previous IDs | mmu-miR-107 |
Sequence |
52 - agcagcauuguacagggcuauca - 74 |
Deep sequencing | 6927902 reads, 107 experiments |
Evidence | experimental; cloned [3-4], Illumina [5,7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|