Stem-loop sequence mmu-mir-107

AccessionMI0000684 (change log)
Symbol MGI:Mir107
DescriptionMus musculus miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

89 open access papers mention mmu-mir-107
(440 sentences)

Stem-loop
   -             --c    u  u           c   u   a 
5'  uucucugugcuuu   agcu cu uacaguguugc uug ggc u
    |||||||||||||   |||| || ||||||||||| ||| ||| g
3'  gagagacacgaaa   ucgg ga auguuacgacg aac uug g
   c             cua    -  c           -   -   a 
Get sequence
Deep sequencing
6928750 reads, 1.73e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-107 is predicted [2] based on homology to a cloned miR from human (MI0000114) [1], and later verified in mouse [3,4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 34820687-34820773 [-]
sense
ENSMUST00000036584 ; Pank1-201; intron 5
ENSMUST00000112460 ; Pank1-202; intron 5
Database links

Mature sequence mmu-miR-107-5p

Accession MIMAT0017048
Previous IDsmmu-miR-107*
Sequence

15 - 

agcuucuuuacaguguugccuug

 - 37

Get sequence
Deep sequencing842 reads, 86 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-107-3p

Accession MIMAT0000647
Previous IDsmmu-miR-107
Sequence

52 - 

agcagcauuguacagggcuauca

 - 74

Get sequence
Deep sequencing6927902 reads, 107 experiments
Evidence experimental; cloned [3-4], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).