Accession | MIMAT0000647 |
Description | mmu-miR-107-3p mature miRNA |
Hairpins | |
Sequence | AGCAGCAUUGUACAGGGCUAUCA |
Evidence |
experimental
cloned [3-4], Illumina [5,7] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0032869 cellular response to insulin stimulus |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | occurs_in UBERON:0002107 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24000013 | has_input UniProtKB:P49817 |
involved_in | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21654750 | occurs_in UBERON:0035818 |
involved_in | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | |
involved_in | GO:0045722 positive regulation of gluconeogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24000013 | occurs_in UBERON:0002107 |
involved_in | GO:0046325 negative regulation of glucose import |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | occurs_in CL:0000136 |
involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21654750 | occurs_in UBERON:0010410 |
involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | occurs_in CL:0000136 |