![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cbr-lin-4 |
|||||
Accession | MI0000492 (change log) | ||||
Description | Caenorhabditis briggsae lin-4 stem-loop | ||||
Gene family | MIPF0000303; lin-4 | ||||
Stem-loop |
a gcuuu g -uu u c a - uc 5' ucagau cg ccug ccc gaga cuca guguga gcgu u |||||| || |||| ||| |||| |||| |||||| |||| g 3' agucug gc ggac ggg cucu gggu cgcacu cgua a g ----- a cau c c c u ca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence cbr-lin-4 |
|
Accession | MIMAT0000464 |
Sequence |
21 - ucccugagaccucaaguguga - 41 |
Evidence | by similarity; MI0000002 |
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|
2 |
PMID:11679672
"An extensive class of small RNAs in Caenorhabditis elegans"
Science. 294:862-864(2001).
|