Stem-loop sequence cbr-lin-4

AccessionMI0000492 (change log)
DescriptionCaenorhabditis briggsae lin-4 stem-loop
Gene family MIPF0000303; lin-4
Stem-loop
   a      gcuuu  g    -uu   u    c    a      -    uc 
5'  ucagau     cg ccug   ccc gaga cuca guguga gcgu  u
    ||||||     || ||||   ||| |||| |||| |||||| ||||  g
3'  agucug     gc ggac   ggg cucu gggu cgcacu cgua  a
   g      -----  a    cau   c    c    c      u    ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrII: 9816746-9816839 [-]
intergenic
Database links

Mature sequence cbr-lin-4

Accession MIMAT0000464
Sequence

21 - 

ucccugagaccucaaguguga

 - 41

Get sequence
Evidence by similarity; MI0000002

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).