miRBase entry: hsa-mir-184

Stem-loop hsa-mir-184


Accession
MI0000481
Symbol
HGNC: MIR184
Description
Homo sapiens hsa-mir-184 precursor miRNA
Gene family
MIPF0000059; mir-184

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR184 is a genetic mutation that has been identified in a limited number of genes [PMC6920454]. It is associated with hepatocellular carcinoma (HCC) cells, which show significant changes in the expression profiles of several oncogenic miRNAs [PMC9741442]. These miRNAs include miR21, miR221/222, miR224, miR17-5p/20a, miR10b, miR106b, miR151-5p, miR155, and miR181a/181b [PMC9741442]. These changes in expression profiles suggest that MIR184 and the other identified oncogenic miRNAs may play a role in the development and progression of HCC [PMC9741442]. However, it is important to note that while there have been numerous linkage loci identified in relation to HCC and genetic mutations have been reported in a limited number of genes including MIR184 and DOCK97 [PMC6920454], there is still much to be understood about the genetic factors contributing to HCC development. Further research is needed to fully elucidate the role of MIR184 and other genetic mutations in HCC.

Literature search
126 open access papers mention hsa-mir-184
(970 sentences)

Sequence

83543 reads, 1603 reads per million, 70 experiments
ccagucacguccccuuaucacuuuuccagcccagcuuugugacuguaaguguUGGACGGAGAACUGAUAAGGGUaggugauuga
.(((((((.(.(((((((((.((((((.(.(((((((((......)))).))))).))))))).))))))))).).))))))).

Structure
c       g c         c      a c     -    ug 
 cagucac u cccuuauca uuuucc g ccagc uuug  a
 ||||||| | ||||||||| |||||| | ||||| ||||   
 guuagug a GGGAAUAGU AAGAGG C GGUug gaau  c
a       g U         C      - A     u    gu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr15: 79209788-79209871 [+]

Disease association
hsa-mir-184 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-184

Accession MIMAT0000454
Description Homo sapiens hsa-miR-184 mature miRNA
Sequence 53 - UGGACGGAGAACUGAUAAGGGU - 74
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179