Stem-loop hsa-mir-150

Accession

MI0000479

Symbol

HGNC: MIR150

Description

Homo sapiens hsa-mir-150 precursor miRNA

Gene family

MIPF0000197; mir-150

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR150 is a microRNA that has been studied in various contexts [PMC6269310]. In one study, the dual regulatory mechanisms of MIR150 expression were investigated, including direct transcriptional activation by MYC and the post-transcriptional inhibition of miR-150 maturation by MYC-driven Lin28 [PMC6269310]. However, the data did not show repression of miR-150 maturation blockade following BCR-ABL1 inhibition in CML cells [PMC6269310]. Another study found that a proximal peak in MIR150 expression coincided with the miR-150 sequence and quickly disappeared after stimulation in naive and memory resting T lymphocytes, suggesting a possible role in the direct control of MIR150 expression [PMC8865640]. Additionally, MIR150 has been identified as one of several free circulating miRNAs that have been isolated in plasma/serum before HCT (hematopoietic cell transplantation), suggesting a possible prognostic use in GVHD (graft-versus-host disease) [PMC9720327]. Furthermore, liver tumor-derived lncRNAs (such as TUC339), circRNAs (such as hsa_circ_0074854), and miRNAs (such as MIR150) have been implicated as critical signaling mediators that orchestrate macrophage M1/M2 polarization [PMC9648394].

Literature search

317 open access papers mention hsa-mir-150
(2132 sentences)

Sequence

58970 reads, 1228 reads per million, 108 experiments

cuccccauggcccugUCUCCCAACCCUUGUACCAGUGcugggcucagaccCUGGUACAGGCCUGGGGGACAGggaccuggggac
.((((((.((((((((((((((..(((.(((((((.((((....))).).))))))))))..)))))))))))).)))))))).

Structure

c      u  -            AC   U       U -   g 
 ucccca gg cccugUCUCCCA  CCU GUACCAG G cug g
 |||||| || ||||||||||||  ||| ||||||| | |||  
 aggggu cc ggGACAGGGGGU  GGA CAUGGUC c gac c
c      -  a            CC   -       c a   u 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

chr19: 49500785-49500868 [-]

Disease association

hsa-mir-150 is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-150 is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-150 is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-150-5p

• Accession: MIMAT0000451
• Description: Homo sapiens hsa-miR-150-5p mature miRNA
• Sequence: 16 - UCUCCCAACCCUUGUACCAGUG - 37
• Evidence: experimental ; cloned [2]

Mature hsa-miR-150-3p

• Accession: MIMAT0004610
• Description: Homo sapiens hsa-miR-150-3p mature miRNA
• Sequence: 51 - CUGGUACAGGCCUGGGGGACAG - 72
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739