Stem-loop sequence hsa-mir-191

Accession

MI0000465 (change log)

Symbol

HGNC:MIR191

Description

Homo sapiens miR-191 stem-loop

Gene family

MIPF0000194; mir-191

Literature search

166 open access papers mention hsa-mir-191
(849 sentences)

Stem-loop

   c   u   c      ca         c  aa       uu  -  c 
5'  ggc gga agcggg  acggaaucc aa  gcagcug  gu cu c
    ||| ||| ||||||  ||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc  ugcuuuagg uu  cgucgac  ua ga a
   u   u   c      cc         -  cg       cu  c  g 

Deep sequencing

2267462 reads, 8.87e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 49020618-49020709 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000345432 ; RP13-131K19.1-001; intron 1

  OTTHUMT00000345433 ; RP13-131K19.1-002; intron 1

  ENST00000415982 ; RP13-131K19.1-001; intron 1

  ENST00000429681 ; RP13-131K19.1-002; intron 1

  antisense

  OTTHUMT00000345437 ; ARIH2-034; exon 2

  OTTHUMT00000345252 ; ARIH2-006; exon 15

  OTTHUMT00000257525 ; ARIH2-001; exon 16

  OTTHUMT00000345248 ; ARIH2-002; exon 17

  ENST00000487891 ; ARIH2-034; exon 2

  ENST00000452385 ; ARIH2-006; exon 15

  ENST00000356401 ; ARIH2-001; exon 16

  ENST00000449376 ; ARIH2-002; exon 17

Clustered miRNAs

< 10kb from hsa-mir-191

• hsa-mir-191: chr3: 49020618-49020709 [-]
• hsa-mir-425: chr3: 49020148-49020234 [-]

Database links

• EntrezGene:MIR191
• HGNC:MIR191
• RNAcentral:URS000075BBD9_9606
• miRBase Tracker:MI0000465

Mature sequence hsa-miR-191-5p

• Accession: MIMAT0000440
• Previous IDs: hsa-miR-191
• Sequence: 16 - caacggaaucccaaaagcagcug - 38
• Deep sequencing: 2265339 reads, 159 experiments
• Evidence: experimental; cloned [2-5]
• Database links:
  • RNAcentral:URS00005C2E31_9606
• Predicted targets:
  • TargetMiner:hsa-miR-191-5p
  • TargetScanVert:hsa-miR-191-5p
  • miRDB:hsa-miR-191-5p
  • microrna.org:hsa-miR-191-5p

Mature sequence hsa-miR-191-3p

• Accession: MIMAT0001618
• Previous IDs: hsa-miR-191*
• Sequence: 58 - gcugcgcuuggauuucgucccc - 79
• Deep sequencing: 2087 reads, 135 experiments
• Evidence: experimental; cloned [2-4]
• Database links:
  • RNAcentral:URS00002B2B5C_9606
• Predicted targets:
  • TargetMiner:hsa-miR-191-3p
  • TargetScanVert:hsa-miR-191-3p
  • miRDB:hsa-miR-191-3p
  • microrna.org:hsa-miR-191-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).