MIR191 is a miRNA that has been found to have concentrations in patients with MHT, and it can provide additional information to improve indications for the need for an initial CCT scan [PMC7430915]. In a study, 36 miRNA orthologs were found to be mutually abundant between tumor types, and among them, MIR191 was one of the most notably expressed miRNA orthologs [PMC9210832]. The study used a circular heatmap in Figure-1 to present the expression levels of these miRNA orthologs [PMC9210832]. Additionally, four MEPNA for MIR191 were prepared with varying gap sizes (1-4 consecutive unmodified nucleotide units), with Amir-0 being an unmodified AO [PMC4005664]. These findings suggest that MIR191 is an important miRNA in the context of tumor types and can potentially be used as a biomarker for diagnostic purposes. Further research is needed to fully understand the role of MIR191 in these contexts.
c u c CA C AA --u cu ggc gga agcggg ACGGAAUCC AA GCAGCUG ugu c ||| ||| |||||| ||||||||| || ||||||| ||| c ccg ccu ucguCC UGCUUUAGG UU CGUCGac acg a u u c CC - CG cuu ag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000440 |
Description | Homo sapiens hsa-miR-191-5p mature miRNA |
Sequence | 16 - CAACGGAAUCCCAAAAGCAGCUG - 38 |
Evidence |
experimental
cloned [2-5] |
Database links | |
Predicted targets |
Accession | MIMAT0001618 |
Description | Homo sapiens hsa-miR-191-3p mature miRNA |
Sequence | 58 - GCUGCGCUUGGAUUUCGUCCCC - 79 |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
|