MIR144 is a microRNA that has been found to downregulate the activity of the MAP3K8/ERK1/2/PPARγ axes, leading to the induction of brown/beige-like characteristics in differentiated adipocytes [PMC9779381]. Overexpression of MIR144 has been shown to significantly increase the expression of human GRβ, while not affecting GRα [PMC5053652]. MIR144, along with miR153, miR27a, and miR142-5p, has been found to inhibit the interaction and binding of these microRNAs with the 3' UTR of human Nrf2, indicating Nrf2 as a direct regulatory target [PMC3517581]. Additionally, MIR144 has been shown to decrease both c-Met and ADAM10 mRNA levels [PMC7352235]. It is worth noting that components of the AP1 complex have been found to regulate the expression of various microRNAs including MIR144 [PMC7123062]. However, other studies have reported an increase in MIR144 levels in colorectal cancer [PMC4599290]. MIR144 is a microRNA that plays a role in regulating various cellular processes. It downregulates MAP3K8/ERK1/2/PPARγ axes activity and induces brown/beige-like characteristics in adipocytes. It also affects GRβ expression and inhibits interaction with Nrf2. Additionally, it reduces c-Met and ADAM10 mRNA levels. However, its role in colorectal cancer is still not fully understood.
-u - u G A -A gc ggg gccc ggcugG AUAUCAUC UAUACUGUA Guuu g ||| |||| |||||| |||||||| ||||||||| |||| ccc cggg cugaUC UGUAGUAG AUAUGACAU caga a cc a c A - ca gu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004600 |
Description | Homo sapiens hsa-miR-144-5p mature miRNA |
Sequence | 15 - GGAUAUCAUCAUAUACUGUAAG - 36 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0000436 |
Description | Homo sapiens hsa-miR-144-3p mature miRNA |
Sequence | 52 - UACAGUAUAGAUGAUGUACU - 71 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|