![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-141 |
||||||
Accession | MI0000457 (change log) | |||||
Symbol | HGNC:MIR141 | |||||
Description | Homo sapiens miR-141 stem-loop | |||||
Gene family | MIPF0000019; mir-8 | |||||
Literature search |
![]()
359 open access papers mention hsa-mir-141 | |||||
Stem-loop |
c g u -u -- u - ugg ua 5' ggcc gccc ggg ccaucuu ccag acaguguu gga uc a |||| |||| ||| ||||||| |||| |||||||| ||| || u 3' uugg uggg ccc gguagaa gguc ugucacaa ccu ag u c g - uc au - u cga ug |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-141 in human [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-141-5p |
|
Accession | MIMAT0004598 |
Previous IDs | hsa-miR-141* |
Sequence |
17 - caucuuccaguacaguguugga - 38 |
Deep sequencing | 5063 reads, 112 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-141-3p |
|
Accession | MIMAT0000432 |
Previous IDs | hsa-miR-141 |
Sequence |
59 - uaacacugucugguaaagaugg - 80 |
Deep sequencing | 741123 reads, 153 experiments |
Evidence | experimental; cloned [2-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|