miRBase entry: hsa-mir-135a-2

Stem-loop hsa-mir-135a-2


Accession
MI0000453
Symbol
HGNC: MIR135A2
Description
Homo sapiens hsa-mir-135a-2 precursor miRNA
Gene family
MIPF0000028; mir-135

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR135A2 is a microRNA that has been investigated for its role in modulating midbrain development [PMC3861205]. In a study, the researchers aimed to determine if MIR135A2 is capable of repressing Lmx1b, a gene involved in midbrain development [PMC3861205]. To test this hypothesis, they conducted a luciferase assay in HEK293 cells [PMC3861205]. The results showed that MIR135A2 was able to repress a construct containing a fragment of the Lmx1b 3′UTR [PMC3861205'>PMC3861205'>PMC3861205'>PMC3861205]. However, when constructs with mutations within the evolutionarily conserved MIR135A2 binding site of the Lmx1b 3′UTR were used, repression was not observed [PMC3861205]. These findings suggest that MIR135A2 specifically targets and represses Lmx1b through its binding site within the 3′UTR of the gene [PMC3861205]. This study provides evidence for the role of MIR135A2 in modulating midbrain development by regulating Lmx1b expression [PMC3861205]. Further research is needed to fully understand the mechanisms and implications of this regulatory interaction [PMC3861205].

Literature search
151 open access papers mention hsa-mir-135a-2
(509 sentences)

Sequence

7823 reads, 262 reads per million, 92 experiments
agauaaauucacucuagugcuuUAUGGCUUUUUAUUCCUAUGUGAuaguaauaaagucucAUGUAGGGAUGGAAGCCAUGAAauacauugugaaaaauca
.(((...(((((....(((.((((((((((((.((((((((((((.(.(.....).).)))))))))))))))))))))))).)))...)))))..))).

Structure
a   aaa     ucua   c            U            u g a 
 gau   uucac    gug uuUAUGGCUUUU AUUCCUAUGUGA a u a
 |||   |||||    ||| |||||||||||| |||||||||||| | | u
 cua   aagug    cau AAGUACCGAAGG UAGGGAUGUAcu u a a
a   -aa     -uua   a            -            c g a 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
chr12: 97563812-97563911 [+]

Disease association
hsa-mir-135a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-135a-5p

Accession MIMAT0000428
Description Homo sapiens hsa-miR-135a-5p mature miRNA
Sequence 23 - UAUGGCUUUUUAUUCCUAUGUGA - 45
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-135a-2-3p

Accession MIMAT0037309
Description Homo sapiens hsa-miR-135a-2-3p mature miRNA
Sequence 61 - AUGUAGGGAUGGAAGCCAUGAA - 82
Evidence not_experimental

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739